Miri Technologies Inc. has begun shipping its highly anticipated V410 live 4K video encoder/decoder for streaming, IP-based production workflows and AV-over-IP distribution. Winner of a 2026 NAB Show ...
Haier 1.5 Ton 4 Star Triple Inverter Split AC (5250 W, Copper, 7 in 1 Convertible, 4-Way Swing, Frost Self Clean, HD Filter, Cools at 60°C, 20 Mtr. Air Throw - HSU18K-PYSC4BN-INV, White)View Details ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results