The University of Chicago's joint-degree program in law and business places students at the intersection of legal and business expertise. By offering both a three-year accelerated JD/MBA and a ...
Products Market Alerts MyCollection Price Database Become a Partner Gallery ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Adam Hayes, Ph.D., CFA, is a financial writer with 15+ years Wall Street experience as a derivatives trader. Besides his extensive derivative trading expertise, Adam is an expert in economics and ...